Review



hibernate a medium brain bits  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    New England Biolabs hibernate a medium brain bits
    Hibernate A Medium Brain Bits, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 337 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hibernate+a+medium+brain+bits/SNAP-Cell+647-SiR/pm38554708-640-49-58
    Average 98 stars, based on 337 article reviews
    hibernate a medium brain bits - by Bioz Stars, 2026-10
    98/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Blocking Assay:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Staining:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Bicinchoninic Acid Protein Assay:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Plasmid Preparation:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Isolation:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Sequencing:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Recombinant:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317

    Modification:

    Article Title: Spastin locally amplifies microtubule dynamics to pattern the axon for presynaptic cargo delivery.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-a/b-Tubulin, rabbit polyclonal Cell Signaling Cat# 2148; RRID:AB_2288042 Anti-acetylated Tubulin, mouse monoclonal Sigma-Aldrich Cat# T7451; RRID:AB_609894 Anti-EB3, rat monoclonal Abcam Cat# ab53360; RRID:AB_880026 Anti-gamma-Tubulin, rabbit monoclonal Sigma-Aldrich Cat# T6557; RRID:AB_477584 Anti-MAP2, mouse monoclonal EMD millipore Cat# MAB3418; RRID:AB_11212326 Anti-polyglutamate chain, rabbit polyclonal AdipoGen Cat# AG-25B-0030; RRID:AB_2490540 Anti-PSD95, rabbit monoclonal Synaptic Systems Cat# 124-008; RRID:AB_2832231 Anti-Spastin, mouse monoclonal Santa Cruz Cat# sc-53443; RRID:AB_785771 Anti-Synapsin 1/2, guinea pig polyclonal Synaptic Systems Cat# 106 004; RRID:AB_1106784 Anti-Synaptophysin, mouse monoclonal Sigma-Aldrich Cat# S5768; RRID:AB_477523 Anti-VAMP2, rabbit monoclonal Cell Signaling Cat# 13508; RRID:AB_2798240 Anti-VGLUT1, goat polyclonal Synaptic Systems Cat# 135-307; RRID:AB_2619821 Bacterial and virus strains NEB Stable Competent E. coli (High Efficiency) New England Biolabs Cat# C3040I NEB Turbo Competent E. coli New England Biolabs Cat# C2984 Chemicals, peptides, and recombinant proteins DMSO Sigma-Aldrich Cat# D2650 Spastazoline MedChemExpress Cat# HY-111548 HBSS (10x) Thermo Fisher Cat# 14185-052 1M HEPES Thermo Fisher Cat# 15630-080 Trypsin-EDTA (0.25%) Thermo Fisher Cat# 25200056 2.5% Trypsin Thermo Fisher Cat# 15090-046 Dulbecco’s Minimum essential medium (MEM) Corning Cat# 10-017-CM Penicillin-Streptomycin Thermo Fisher Cat# 15140122 Fetal Bovine Serum HyClone Cat# SH30071.03 Non-essential Amino Acids (NEAA) Thermo Fisher Cat# 11140050 FUGENE 6 Transfection Reagent Promega Cat# E2692 AraC Sigma-Aldrich Cat# C6645 Matrigel Growth Factor Reduced Corning Cat# 354230 Essential 8 Medium Thermo Fisher Cat# A1517001 mTeSR Medium StemCell Technologies, Inc. StemCell Cat# 85850 ReLeSR StemCell Technologies, Inc. Cat# 05872 Accutase StemCell Technologies, Inc. Cat# 07920 ROCK Inhibitor Y-27632 Tocris Cat# 125410 Tet System Approved FBS Takara Cat# 631107 DMEM/F-12, HEPES Thermo Fisher Cat# 11330032 GlutaMAX Supplement Thermo Fisher Cat# 35050-061 N2 Supplement Thermo Fisher Cat# 17502048 B27 Supplement Thermo Fisher Cat# 17504-044 Doxycycline Sigma-Aldrich Cat# D9891 Poly-L-Ornithine Sigma-Aldrich Cat# P3655 BrainPhys Neuronal Medium StemCell Technologies, Inc. Cat# 05790 Laminin Corning Cat# 354232 (Continued on next page) Current Biology 34, 1–18.e1–e8, April 22, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER BDNF PeproTech Cat# 450-02 NT-3 PeproTech Cat# 450-03 GDNF PeproTech Cat# 450-10 Lipofectamine Stem Transfection Reagent Thermo Fisher Cat# STEM00003 Halt Protease and Phosphatase Inhibitor Cocktail Thermo Fisher Cat# 78442 ViralBoost Alstem Cat# VB100 Lentivirus Precipitation Solution Alstem Cat# VC100 Puromycin Takara Cat# 631305 Hibernate A Medium Brain Bits Cat# HA100 SNAP-Cell 647-SiR New England BioLabs Cat# S9102S SynaptoRed C2 Biotium Cat# 70027 D-AP5 Thomas Scientific Cat# 14539–5 ADVASEP-7 Biotium Cat# 70029 CNQX Thomas Scientific Cat# 14618–5 EveryBlot Blocking Buffer BIO-RAD Cat# 12010020 LI-COR Revert 700 Total Protein Stain LI-COR Cat# 926–11021 Critical commercial assays BCA Protein Assay Kit Thermo Fisher Cat# 23225 Plasmid Maxi Kit QIAGEN Cat# 12163 Experimental models: Cell lines Human: NGN2 iPSCs M. Ward (National Institutes of Health)31 N/A Human: HEK293T ATCC Cat# CRL-3216; RRID:CVCL_0063 Experimental models: Organisms/strains Rat: primary rat astrocytes/glia isolated from postnatal day 1 rat brains (Sprague Dawley) Charles River Laboratories RRID: RGD_737891 Oligonucleotides Spastin-specific sgRNA guide: GACCGACGGGAACCAAGCGA Horlbeck et al.39 N/A Non-targeting sgRNA guide: GTGCCAGCTTGTGGTGTCGT Horlbeck et al.39 N/A pCRISPRia-vs2 sequencing forward oligo: ggcttggatttctataacttcg This paper N/A pCRISPRia-vs2 sequencing reverse oligo: ctactgcacttatatacggttc This paper N/A Recombinant DNA Plasmid: pCRISPRia-vs2 Addgene Cat# 84832 Plasmid: pCRISPRia-vs2-Spastin Modified from pCRISPRia-vs2 N/A Plasmid: pCRISPRia-vs2-NT Modified from pCRISPRia-vs2 N/A Plasmid: pCMV-Vsv-g Addgene Cat# #8454 Plasmid: psPAX2 (HIV pol+gag) Addgene Cat# 12260 Plasmid: pCI-mScarlet Addgene Cat# 85042 Plasmid: pC1-mScarlet-Syp Modified from pCI-mScarlet N/A Plasmid: pCIG2-GFP-MACF43 Aiken et al.51 N/A Plasmid: pEGFP-C3-Syb Addgene Cat# 42308 Plasmid: pmScarlet-Syb Modified from pEGFP-C3-Syb N/A Plasmid: pCIG2-mScarlet-SybIRES-GFP-MACF43 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pCIG2-SNAP-M87 Modified from pCIG2-GFP-MACF43 N/A Plasmid: pSNAPf New England Biolabs Cat# N9183S Plasmid: pCMV-Tag/WT M87 Addgene Cat# 89322 (Continued on next page) e2 Current Biology 34, 1–18.e1–e8, April 22, 2024 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Plasmid: pBI-CMV2 Clontech Cat# 631631 Plasmid: pBI-BFP Modified from pBI-CMV2 N/A Plasmid: pTagBFP-N Evrogen Cat# FP172 Plasmid: pCAG-NL1 Addgene Cat# 15260 Plasmid: pBI-NL1-BFP Modified from pBI-BFP N/A Software and algorithms FIJI NIH, USA http://fiji.sc; RRID:SCR_002285 Prism 10 GraphPad https://www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Volocity PerkinElmer https://www.perkinelmer.com; RRID:SCR_002668 VisiView 5.0.0.24 Visitron https://www.visitron.de/products/ visiviewr-software.html; RRID:SCR_022546 Kymograph Clear 2.0a (FIJI plugin) Mangeol et al.58 https://sites.google.com/ site/kymographanalysis/ SynapseJ (FIJI Plugin) Moreno Manrique et al.59 https://github.com/GB3Trinity/SynapseJ Adobe Illustrator 2023 Adobe https://www.adobe.com/products/ illustrator.html; RRID:SCR_010279 LI-COR Image Studio LI-COR https://www.licor.com/bio/ image-studio/; RRID:SCR_015795 Other 35 mm #1.5 glass bottom imaging dishes MatTek Cat# P35G-1.5-20-C ProLong Gold Antifade Mountant Thermo Fisher Cat# P36930 XonaChip microfluidic chambers Xona Microfluidics Cat# XC450 Immobilon -FL PVDF membranes Millipore Cat# 05317



    Similar Products

    hibernate a medium brain bits  (New England Biolabs)
    98
    New England Biolabs hibernate a medium brain bits
    Hibernate A Medium Brain Bits, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/hibernate+a+medium+brain+bits/SNAP-Cell+647-SiR/pm38554708-640-49-58
    Average 98 stars, based on 1 article reviews
    hibernate a medium brain bits - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier

    Image Search Results